Transcript: Mouse NM_181584.4

Mus musculus growth factor receptor bound protein 2-associated protein 3 (Gab3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gab3 (210710)
Length:
2129
CDS:
167..1954

Additional Resources:

NCBI RefSeq record:
NM_181584.4
NBCI Gene record:
Gab3 (210710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181584.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100171 CGTGTGATAGACCTCAGTGAA pLKO.1 338 CDS 100% 4.950 3.960 N Gab3 n/a
2 TRCN0000100173 CAGATGTGATAGCTGGTCAAA pLKO.1 769 CDS 100% 4.950 3.465 N Gab3 n/a
3 TRCN0000100172 CCCACAGTTCATGTAGAAGAA pLKO.1 1010 CDS 100% 4.950 3.465 N Gab3 n/a
4 TRCN0000100174 CCAGATGTGATAGCTGGTCAA pLKO.1 768 CDS 100% 4.050 2.835 N Gab3 n/a
5 TRCN0000100170 GCCTTTATTTCTAAGTTCTCT pLKO.1 1981 3UTR 100% 3.000 1.500 Y Gab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181584.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.