Transcript: Mouse NM_181593.2

Mus musculus inositol 1,4,5-trisphosphate 3-kinase C (Itpkc), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Itpkc (233011)
Length:
3260
CDS:
111..2147

Additional Resources:

NCBI RefSeq record:
NM_181593.2
NBCI Gene record:
Itpkc (233011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025569 CGAACTGGACAGATCCGATAT pLKO.1 626 CDS 100% 10.800 8.640 N Itpkc n/a
2 TRCN0000362194 CAACAAGCCCAGGGTTGATAA pLKO_005 671 CDS 100% 13.200 9.240 N Itpkc n/a
3 TRCN0000362120 CCAGAGGACCAGGCATCATTT pLKO_005 2411 3UTR 100% 13.200 9.240 N Itpkc n/a
4 TRCN0000362193 GAACTGGACAGATCCGATATG pLKO_005 627 CDS 100% 10.800 7.560 N Itpkc n/a
5 TRCN0000275164 GGTCGGATTCTGAAACGTTTC pLKO_005 1374 CDS 100% 6.000 4.200 N ITPKC n/a
6 TRCN0000025572 CAGGTGACAAAGGTGTTAGAA pLKO.1 1821 CDS 100% 5.625 3.938 N Itpkc n/a
7 TRCN0000025570 GCCTTCAACCAGATGGAAGAT pLKO.1 1491 CDS 100% 4.950 3.465 N Itpkc n/a
8 TRCN0000025571 GCTTCTGGATAGAGTCCCAAA pLKO.1 820 CDS 100% 4.050 2.835 N Itpkc n/a
9 TRCN0000025573 CACCAGAATCAAGTGCTGATA pLKO.1 745 CDS 100% 4.950 2.970 N Itpkc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.