Transcript: Human NM_181661.2

Homo sapiens vacuolar protein sorting 13 homolog B (VPS13B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
VPS13B (157680)
Length:
1634
CDS:
112..1359

Additional Resources:

NCBI RefSeq record:
NM_181661.2
NBCI Gene record:
VPS13B (157680)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083957 CTGCCTATGTTTATTCGTATA pLKO.1 922 CDS 100% 10.800 15.120 N VPS13B n/a
2 TRCN0000083955 CGGATCTACAGCTTTCACTAT pLKO.1 182 CDS 100% 4.950 6.930 N VPS13B n/a
3 TRCN0000256669 ATCGTGCATTCATGGATATTT pLKO_005 668 CDS 100% 15.000 12.000 N Vps13b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.