Transcript: Mouse NM_181681.2

Mus musculus phospholipid phosphatase related 3 (Plppr3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plppr3 (216152)
Length:
2790
CDS:
541..2691

Additional Resources:

NCBI RefSeq record:
NM_181681.2
NBCI Gene record:
Plppr3 (216152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080999 GATGTACTTCAACGCGGTTAT pLKO.1 1191 CDS 100% 10.800 15.120 N Plppr3 n/a
2 TRCN0000081000 CGATGTACTTCAACGCGGTTA pLKO.1 1190 CDS 100% 4.050 5.670 N Plppr3 n/a
3 TRCN0000080998 CCCTTACATCACACAGGACAT pLKO.1 1074 CDS 100% 4.050 2.835 N Plppr3 n/a
4 TRCN0000081002 GTCCATGTATCAGCAGAATAA pLKO.1 1470 CDS 100% 13.200 7.920 N Plppr3 n/a
5 TRCN0000081001 GAGTCCATGTATCAGCAGAAT pLKO.1 1468 CDS 100% 4.950 2.970 N Plppr3 n/a
6 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1856 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181681.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.