Transcript: Human NM_181795.3

Homo sapiens cAMP-dependent protein kinase inhibitor beta (PKIB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PKIB (5570)
Length:
1706
CDS:
292..528

Additional Resources:

NCBI RefSeq record:
NM_181795.3
NBCI Gene record:
PKIB (5570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002819 CCACAGACGGAACCTCAGATT pLKO.1 404 CDS 100% 4.950 6.930 N PKIB n/a
2 TRCN0000273290 CCACAGACGGAACCTCAGATT pLKO_005 404 CDS 100% 4.950 6.930 N PKIB n/a
3 TRCN0000002815 CACAGACGGAACCTCAGATTT pLKO.1 405 CDS 100% 13.200 9.240 N PKIB n/a
4 TRCN0000380391 GGCAAATCATTCTTGGTAAAT pLKO_005 876 3UTR 100% 13.200 9.240 N PKIB n/a
5 TRCN0000381106 GTGGTAACTGTGGTAACATTG pLKO_005 610 3UTR 100% 10.800 7.560 N PKIB n/a
6 TRCN0000273353 TGAAGGCTCATAATCTATCAA pLKO_005 526 CDS 100% 5.625 3.938 N PKIB n/a
7 TRCN0000002818 CCCTAACTTTGGTCTGTGTAT pLKO.1 1220 3UTR 100% 4.950 3.465 N PKIB n/a
8 TRCN0000002817 CCTTACCAGACATCCAGAGTT pLKO.1 377 CDS 100% 4.950 3.465 N PKIB n/a
9 TRCN0000273289 TCTCCGTGAAGGAAGATGCAA pLKO_005 446 CDS 100% 3.000 2.100 N PKIB n/a
10 TRCN0000002816 CCAGACATCCAGAGTTCAGCT pLKO.1 382 CDS 100% 2.640 1.848 N PKIB n/a
11 TRCN0000273287 CCAGACATCCAGAGTTCAGCT pLKO_005 382 CDS 100% 2.640 1.848 N PKIB n/a
12 TRCN0000273351 ATGTCCAAGGTAAGCTATTAA pLKO_005 699 3UTR 100% 15.000 9.000 N PKIB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.