Transcript: Human NM_181800.3

Homo sapiens ubiquitin conjugating enzyme E2 C (UBE2C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
UBE2C (11065)
Length:
690
CDS:
53..505

Additional Resources:

NCBI RefSeq record:
NM_181800.3
NBCI Gene record:
UBE2C (11065)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181800.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004241 CCCTTACAATGCGCCCACAGT pLKO.1 232 CDS 100% 0.880 0.704 N UBE2C n/a
2 TRCN0000349490 CCCTTACAATGCGCCCACAGT pLKO_005 232 CDS 100% 0.880 0.704 N UBE2C n/a
3 TRCN0000368929 TGTATGATGTCAGGACCATTC pLKO_005 339 CDS 100% 6.000 4.200 N UBE2C n/a
4 TRCN0000368994 GCCTGTCCTTGTGTCGTCTTT pLKO_005 519 3UTR 100% 4.950 3.465 N UBE2C n/a
5 TRCN0000004243 CCTGCAAGAAACCTACTCAAA pLKO.1 460 CDS 100% 4.950 2.970 N UBE2C n/a
6 TRCN0000318465 CCTGCAAGAAACCTACTCAAA pLKO_005 460 CDS 100% 4.950 2.970 N UBE2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181800.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.