Transcript: Human NM_181808.4

Homo sapiens DNA polymerase nu (POLN), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLN (353497)
Length:
3253
CDS:
355..3057

Additional Resources:

NCBI RefSeq record:
NM_181808.4
NBCI Gene record:
POLN (353497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181808.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435823 TTATGGTTTATGGCAACTATT pLKO_005 1605 CDS 100% 13.200 18.480 N POLN n/a
2 TRCN0000053080 GCATCCTAATATCCAAGGTAT pLKO.1 2079 CDS 100% 4.950 6.930 N POLN n/a
3 TRCN0000053081 CCATGCCATTCAGGTGAACAA pLKO.1 1674 CDS 100% 4.950 3.465 N POLN n/a
4 TRCN0000053082 CCTTCATCCATTACCCAAGAT pLKO.1 1926 CDS 100% 4.950 3.465 N POLN n/a
5 TRCN0000053078 CCTGGTGATAACTGTGATGTA pLKO.1 1014 CDS 100% 4.950 2.970 N POLN n/a
6 TRCN0000053079 CCAGTGTTGCTCAGAAGATTA pLKO.1 407 CDS 100% 13.200 6.600 Y POLN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181808.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.