Transcript: Mouse NM_181857.4

Mus musculus DNA polymerase N (Poln), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Poln (272158)
Length:
2994
CDS:
144..2744

Additional Resources:

NCBI RefSeq record:
NM_181857.4
NBCI Gene record:
Poln (272158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181857.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120294 GCCAGGTTAGTTGCCCAAATT pLKO.1 2529 CDS 100% 13.200 18.480 N Poln n/a
2 TRCN0000120293 GCACCCAATTAAGATTTCTAA pLKO.1 1898 CDS 100% 5.625 7.875 N Poln n/a
3 TRCN0000120295 GCACCTTCATTTGAAGATTTA pLKO.1 1230 CDS 100% 13.200 9.240 N Poln n/a
4 TRCN0000120292 CCTACTCACATGAAGGACATT pLKO.1 2782 3UTR 100% 4.950 3.465 N Poln n/a
5 TRCN0000120296 CCTCCATTACTAAGCTCACAT pLKO.1 421 CDS 100% 4.950 3.465 N Poln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181857.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.