Transcript: Human NM_181882.3

Homo sapiens periaxin (PRX), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
PRX (57716)
Length:
4867
CDS:
284..4669

Additional Resources:

NCBI RefSeq record:
NM_181882.3
NBCI Gene record:
PRX (57716)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181882.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119053 CCGAGTGTTCTTCGAGAACTT pLKO.1 487 CDS 100% 4.950 6.930 N PRX n/a
2 TRCN0000119054 CGAGCCTTACAAAGTCTCCTT pLKO.1 544 CDS 100% 2.640 3.696 N PRX n/a
3 TRCN0000119052 CCAGAGATGAAACTCCCTAAA pLKO.1 2270 CDS 100% 10.800 7.560 N PRX n/a
4 TRCN0000436803 GTGTCTGGCTACGAGATCAAG pLKO_005 617 CDS 100% 4.950 3.465 N PRX n/a
5 TRCN0000119055 TGGTGGAAATTATCGTGGAGA pLKO.1 330 CDS 100% 2.640 1.848 N PRX n/a
6 TRCN0000119056 CGAGAACTTCAAGTACGAGGA pLKO.1 499 CDS 100% 2.160 1.512 N PRX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181882.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.