Transcript: Mouse NM_181989.1

Mus musculus short chain dehydrogenase/reductase family 16C, member 5 (Sdr16c5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Sdr16c5 (242285)
Length:
1379
CDS:
230..1159

Additional Resources:

NCBI RefSeq record:
NM_181989.1
NBCI Gene record:
Sdr16c5 (242285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041218 CCGGTGAGATAGTGCTCATAA pLKO.1 345 CDS 100% 13.200 18.480 N Sdr16c5 n/a
2 TRCN0000041220 GCCTGCCATGATTGCTAACAA pLKO.1 712 CDS 100% 5.625 7.875 N Sdr16c5 n/a
3 TRCN0000041221 GCAGAATCTATGTTTATCGAA pLKO.1 830 CDS 100% 3.000 4.200 N Sdr16c5 n/a
4 TRCN0000041219 GCAAGTAAATTCGCAGCCCTT pLKO.1 803 CDS 100% 2.160 3.024 N Sdr16c5 n/a
5 TRCN0000041222 GCTCTACTTGTATATGCCCAA pLKO.1 1015 CDS 100% 2.160 3.024 N Sdr16c5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.