Transcript: Human NM_182495.6

Homo sapiens neurexophilin and PC-esterase domain family member 2 (NXPE2), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
NXPE2 (120406)
Length:
1868
CDS:
50..1729

Additional Resources:

NCBI RefSeq record:
NM_182495.6
NBCI Gene record:
NXPE2 (120406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182495.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142155 GATGTACTCCACAGCACTAAT pLKO.1 508 CDS 100% 13.200 18.480 N NXPE2 n/a
2 TRCN0000141635 CATGACCACTAGGACAAGAAA pLKO.1 853 CDS 100% 5.625 3.938 N NXPE2 n/a
3 TRCN0000140346 CCTGAACCAAGGGAACATCTT pLKO.1 211 CDS 100% 4.950 3.465 N NXPE2 n/a
4 TRCN0000140385 GCAAGGAACCAAGGATGTGAT pLKO.1 665 CDS 100% 4.950 3.465 N NXPE2 n/a
5 TRCN0000140621 GCAAGGAAGAATGGAGGCTTT pLKO.1 888 CDS 100% 4.050 2.835 N NXPE2 n/a
6 TRCN0000142251 GAACCAAGGATGTGATAGGAT pLKO.1 670 CDS 100% 3.000 2.100 N NXPE2 n/a
7 TRCN0000140194 GTTTGCCAACAGAAGCTCCAA pLKO.1 706 CDS 100% 2.640 1.848 N NXPE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182495.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.