Transcript: Mouse NM_183023.1

Mus musculus regulating synaptic membrane exocytosis 4 (Rims4), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rims4 (241770)
Length:
832
CDS:
1..810

Additional Resources:

NCBI RefSeq record:
NM_183023.1
NBCI Gene record:
Rims4 (241770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243909 GGGCAAAGTCCTGCAGGTAAT pLKO_005 576 CDS 100% 10.800 15.120 N Rims4 n/a
2 TRCN0000007015 ACCTTAACTATGGAGGAGTTT pLKO.1 236 CDS 100% 4.950 3.960 N RIMS4 n/a
3 TRCN0000243907 ACACTGCCAGCTGCCTATATC pLKO_005 442 CDS 100% 13.200 9.240 N Rims4 n/a
4 TRCN0000243908 ACAACCAGGTGCTTCTGTTTC pLKO_005 542 CDS 100% 10.800 7.560 N Rims4 n/a
5 TRCN0000243906 CAGAGGGCAACCTTAACTATG pLKO_005 227 CDS 100% 10.800 7.560 N Rims4 n/a
6 TRCN0000243905 GTATGGGACCAGCACAGTTTG pLKO_005 296 CDS 100% 10.800 7.560 N Rims4 n/a
7 TRCN0000007017 CATCTACTTCCCGTGCATGAA pLKO.1 54 CDS 100% 4.950 3.465 N RIMS4 n/a
8 TRCN0000420535 GATGGAGCGGAAGCAGTTCAT pLKO_005 618 CDS 100% 4.950 3.465 N RIMS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183023.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.