Transcript: Mouse NM_183034.1

Mus musculus pleckstrin homology domain containing, family M (with RUN domain) member 1 (Plekhm1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Plekhm1 (353047)
Length:
5144
CDS:
114..3338

Additional Resources:

NCBI RefSeq record:
NM_183034.1
NBCI Gene record:
Plekhm1 (353047)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242241 GAGCTCTTGGCTTACCTAATA pLKO_005 3976 3UTR 100% 13.200 18.480 N Plekhm1 n/a
2 TRCN0000345633 AGCTGTCCTGCAGCCTAAATT pLKO_005 892 CDS 100% 15.000 10.500 N Plekhm1 n/a
3 TRCN0000242242 CACGGTTGTGCGAGTACTATC pLKO_005 538 CDS 100% 10.800 7.560 N Plekhm1 n/a
4 TRCN0000198651 CCAACACTCAGGCCATAAGAT pLKO.1 812 CDS 100% 5.625 3.938 N Plekhm1 n/a
5 TRCN0000181589 GAAGTTTGCTACCAGGGAGAA pLKO.1 2570 CDS 100% 4.050 2.835 N Plekhm1 n/a
6 TRCN0000198296 GATGCTATCAAAGAGTCCCTT pLKO.1 2214 CDS 100% 2.640 1.848 N Plekhm1 n/a
7 TRCN0000345638 TCAGCAAAGCCCAGGTAAATT pLKO_005 1048 CDS 100% 15.000 9.000 N Plekhm1 n/a
8 TRCN0000242240 CAGAACCAGATGCTATCAAAG pLKO_005 2206 CDS 100% 10.800 6.480 N Plekhm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.