Transcript: Mouse NM_183036.1

Mus musculus defensin beta 38 (Defb38), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Defb38 (360212)
Length:
192
CDS:
1..192

Additional Resources:

NCBI RefSeq record:
NM_183036.1
NBCI Gene record:
Defb38 (360212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110876 GATCCTCTCTCTATATTTCTT pLKO.1 27 CDS 100% 5.625 4.500 N Defb38 n/a
2 TRCN0000110877 CTCTATATTTCTTCCAGATCA pLKO.1 35 CDS 100% 4.950 3.465 N Defb38 n/a
3 TRCN0000110875 CTCTCTATATTTCTTCCAGAT pLKO.1 33 CDS 100% 4.050 2.835 N Defb38 n/a
4 TRCN0000110879 TATTTCTTCCAGATCAACCAA pLKO.1 40 CDS 100% 3.000 2.100 N Defb38 n/a
5 TRCN0000110878 TCTCTCTATATTTCTTCCAGA pLKO.1 32 CDS 100% 2.640 1.848 N Defb38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183036.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.