Transcript: Mouse NM_183037.2

Mus musculus tripartite motif-containing 46 (Trim46), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Trim46 (360213)
Length:
3132
CDS:
121..2400

Additional Resources:

NCBI RefSeq record:
NM_183037.2
NBCI Gene record:
Trim46 (360213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242249 ATGCCAGCAAGAGCGCTTATC pLKO_005 1131 CDS 100% 10.800 15.120 N Trim46 n/a
2 TRCN0000242248 CTCAAGGATAAGCTAACAAAG pLKO_005 928 CDS 100% 10.800 8.640 N Trim46 n/a
3 TRCN0000242247 CACCTTTGCCTATGATCAAAT pLKO_005 1437 CDS 100% 13.200 9.240 N Trim46 n/a
4 TRCN0000216860 GGAACACTGGATATGACTAAC pLKO.1 2734 3UTR 100% 10.800 7.560 N Trim46 n/a
5 TRCN0000242251 GGAACACTGGATATGACTAAC pLKO_005 2734 3UTR 100% 10.800 7.560 N Trim46 n/a
6 TRCN0000181032 CCTTCTGTAACGAATGCTTCA pLKO.1 695 CDS 100% 4.050 2.835 N Trim46 n/a
7 TRCN0000196160 GAGATGTACAAGCAGCCACTA pLKO.1 232 CDS 100% 4.050 2.835 N Trim46 n/a
8 TRCN0000242250 TATGCGCAGGAAGTCCTTAAG pLKO_005 1213 CDS 100% 10.800 6.480 N Trim46 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.