Transcript: Mouse NM_183087.4

Mus musculus family with sequence similarity 189, member A1 (Fam189a1), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Fam189a1 (70638)
Length:
4790
CDS:
206..1753

Additional Resources:

NCBI RefSeq record:
NM_183087.4
NBCI Gene record:
Fam189a1 (70638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183087.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283129 GGCCTCTCTCGCTTGTGATTA pLKO_005 465 CDS 100% 13.200 18.480 N Fam189a1 n/a
2 TRCN0000264709 TGTATCTGACCTCACCTAATT pLKO_005 2554 3UTR 100% 13.200 10.560 N Fam189a1 n/a
3 TRCN0000264710 TCTGGACTTTGATGAGTTTAT pLKO_005 907 CDS 100% 13.200 9.240 N Fam189a1 n/a
4 TRCN0000283126 ATCCACTGGTGACCCAGATAC pLKO_005 1483 CDS 100% 10.800 7.560 N Fam189a1 n/a
5 TRCN0000283123 TGGACTCATTGGTGTTGTTTC pLKO_005 436 CDS 100% 10.800 7.560 N Fam189a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183087.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.