Transcript: Mouse NM_183106.2

Mus musculus tetratricopeptide repeat domain 17 (Ttc17), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Ttc17 (74569)
Length:
4607
CDS:
25..3621

Additional Resources:

NCBI RefSeq record:
NM_183106.2
NBCI Gene record:
Ttc17 (74569)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155667 CCAGGTCAAACGTGTAAAGAA pLKO.1 2715 CDS 100% 5.625 7.875 N TTC17 n/a
2 TRCN0000265303 TGGGTTTGAGCAAGCTATAAA pLKO_005 1002 CDS 100% 15.000 10.500 N Ttc17 n/a
3 TRCN0000323402 TGGGTTTGAGCAAGCTATAAA pLKO_005 1002 CDS 100% 15.000 10.500 N TTC17 n/a
4 TRCN0000257896 CAATATGTTGAAGTCCTATAT pLKO_005 4285 3UTR 100% 13.200 9.240 N Ttc17 n/a
5 TRCN0000249450 CTAGAGCTTCCATATAGTATA pLKO_005 514 CDS 100% 13.200 9.240 N Ttc17 n/a
6 TRCN0000257906 GACATTGCTCTGGTCAATTTG pLKO_005 808 CDS 100% 13.200 9.240 N Ttc17 n/a
7 TRCN0000249451 CCGTGACTCTGATGCGTATAG pLKO_005 1482 CDS 100% 10.800 7.560 N Ttc17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183106.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.