Transcript: Mouse NM_183119.3

Mus musculus RIKEN cDNA 2410141K09 gene (2410141K09Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
2410141K09Rik (76803)
Length:
515
CDS:
97..384

Additional Resources:

NCBI RefSeq record:
NM_183119.3
NBCI Gene record:
2410141K09Rik (76803)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183119.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095709 CGAAGACATACAAGGCCACAT pLKO.1 274 CDS 100% 4.050 3.240 N 2410141K09Rik n/a
2 TRCN0000095710 CGAGGATCTCTAAGAGGCCAT pLKO.1 362 CDS 100% 2.160 1.512 N 2410141K09Rik n/a
3 TRCN0000095711 GATTCCATGACACGGAGTCAT pLKO.1 305 CDS 100% 0.495 0.347 N 2410141K09Rik n/a
4 TRCN0000235272 TTACTTCTATAGGCTACAAAT pLKO_005 215 CDS 100% 13.200 6.600 Y Gm10771 n/a
5 TRCN0000095713 CATGTGAACTTCACTAAAGAA pLKO.1 124 CDS 100% 5.625 2.813 Y 2410141K09Rik n/a
6 TRCN0000095712 CCTTACTTCTATAGGCTACAA pLKO.1 213 CDS 100% 4.950 2.475 Y 2410141K09Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183119.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.