Transcript: Mouse NM_183123.2

Mus musculus serine protease inhibitor, Kazal type-like (Spinkl), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Spinkl (77424)
Length:
593
CDS:
55..327

Additional Resources:

NCBI RefSeq record:
NM_183123.2
NBCI Gene record:
Spinkl (77424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087077 AGGTCCAGAGAATGTTATTAA pLKO.1 138 CDS 100% 15.000 10.500 N Spinkl n/a
2 TRCN0000087074 GCACCATGTATAAGAGTAAAT pLKO.1 170 CDS 100% 13.200 9.240 N Spinkl n/a
3 TRCN0000087073 CCAACAAATGAAGTCTTCTAT pLKO.1 390 3UTR 100% 5.625 3.938 N Spinkl n/a
4 TRCN0000087075 GTGCTCCAATATCGCTGAGAA pLKO.1 195 CDS 100% 4.950 3.465 N Spinkl n/a
5 TRCN0000087076 CAATGAGTGTTACTTCTGCAT pLKO.1 249 CDS 100% 2.640 1.848 N Spinkl n/a
6 TRCN0000087136 GTCCTCAACATGGATCAAATT pLKO.1 57 CDS 100% 13.200 6.600 Y Spink11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.