Transcript: Mouse NM_183185.3

Mus musculus zinc finger protein 300 (Zfp300), mRNA.

Source:
NCBI, updated 2017-05-02
Taxon:
Mus musculus (mouse)
Gene:
Zfp300 (245368)
Length:
4658
CDS:
285..2222

Additional Resources:

NCBI RefSeq record:
NM_183185.3
NBCI Gene record:
Zfp300 (245368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082014 CGGAAGTCATACCTCATGTTA pLKO.1 1800 CDS 100% 5.625 7.875 N Zfp300 n/a
2 TRCN0000082017 CCCTATTCAGAGGAGCCTATA pLKO.1 359 CDS 100% 10.800 8.640 N Zfp300 n/a
3 TRCN0000417161 AGGAGTCCTTGGGATAATAAA pLKO_005 467 CDS 100% 15.000 10.500 N Zfp300 n/a
4 TRCN0000082013 CCTGTGTTCAATCCAATAAAT pLKO.1 4073 3UTR 100% 15.000 10.500 N Zfp300 n/a
5 TRCN0000433039 GAGCAAGCTATATCCATTATT pLKO_005 576 CDS 100% 15.000 10.500 N Zfp300 n/a
6 TRCN0000082015 CCAGAAGTGATCGCCTCTTTA pLKO.1 441 CDS 100% 13.200 9.240 N Zfp300 n/a
7 TRCN0000082016 CCAAGTTCATTCCTTGTTGTT pLKO.1 960 CDS 100% 4.950 3.465 N Zfp300 n/a
8 TRCN0000422274 AGGAGTCAACACTGCATATAC pLKO_005 1129 CDS 100% 13.200 7.920 N Zfp300 n/a
9 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 1931 CDS 100% 10.800 5.400 Y Gm14393 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.