Transcript: Mouse NM_183221.3

Mus musculus FAT atypical cadherin 4 (Fat4), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Fat4 (329628)
Length:
16109
CDS:
21..14966

Additional Resources:

NCBI RefSeq record:
NM_183221.3
NBCI Gene record:
Fat4 (329628)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257814 GACGCGGACATAGGATCTAAT pLKO_005 7500 CDS 100% 13.200 18.480 N Fat4 n/a
2 TRCN0000248881 GACCTATGCAGGCCCTAATTG pLKO_005 15750 3UTR 100% 13.200 10.560 N Fat4 n/a
3 TRCN0000248880 AGTACCGATGTCACCATATTT pLKO_005 8589 CDS 100% 15.000 10.500 N Fat4 n/a
4 TRCN0000248878 GCACCCTGAGTATCGATATTT pLKO_005 3916 CDS 100% 15.000 10.500 N Fat4 n/a
5 TRCN0000248879 ACGATGATCAAGGTCCAAATA pLKO_005 6877 CDS 100% 13.200 9.240 N Fat4 n/a
6 TRCN0000192604 GCCCAAGTTATCTCAAGTCAA pLKO.1 14627 CDS 100% 4.950 3.465 N Fat4 n/a
7 TRCN0000192780 CCTCTTCTGAAGAAGACTGTA pLKO.1 14464 CDS 100% 0.495 0.347 N Fat4 n/a
8 TRCN0000192086 CGATGCAGATGACGAAGATAA pLKO.1 14654 CDS 100% 13.200 7.920 N Fat4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183221.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.