Transcript: Mouse NM_183270.2

Mus musculus cytochrome c oxidase assembly factor 4 (Coa4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Coa4 (68185)
Length:
834
CDS:
104..367

Additional Resources:

NCBI RefSeq record:
NM_183270.2
NBCI Gene record:
Coa4 (68185)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182564 GCCTTCAGGGATTGTATGAGT pLKO.1 281 CDS 100% 3.000 4.200 N Coa4 n/a
2 TRCN0000215939 CATTCTTGTTCTACCAATATT pLKO.1 563 3UTR 100% 15.000 10.500 N Coa4 n/a
3 TRCN0000217931 GACTGTGTGCCAAGTACTTTA pLKO.1 623 3UTR 100% 13.200 9.240 N Coa4 n/a
4 TRCN0000216048 CATATCCTCCACATTCTTGTT pLKO.1 552 3UTR 100% 4.950 3.465 N Coa4 n/a
5 TRCN0000182769 CCGGTGAAGAAGGATGATGAT pLKO.1 143 CDS 100% 4.950 3.465 N Coa4 n/a
6 TRCN0000181762 GAAGGATGATGATGAGGAAGA pLKO.1 151 CDS 100% 4.050 2.835 N Coa4 n/a
7 TRCN0000182770 CCTGGGAAGAAGAAACCCTAA pLKO.1 420 3UTR 100% 4.050 2.430 N Coa4 n/a
8 TRCN0000181523 GAAGAAGGATGATGATGAGGA pLKO.1 148 CDS 100% 2.640 1.584 N Coa4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.