Transcript: Mouse NM_183271.2

Mus musculus WAP four-disulfide core domain 15A (Wfdc15a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Wfdc15a (68221)
Length:
466
CDS:
82..324

Additional Resources:

NCBI RefSeq record:
NM_183271.2
NBCI Gene record:
Wfdc15a (68221)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436042 GGGTACTGTCCGGAGTTTCTT pLKO_005 181 CDS 100% 5.625 7.875 N Wfdc15a n/a
2 TRCN0000114725 GCAGCCTAGAGCAACTAGGAA pLKO.1 141 CDS 100% 0.300 0.420 N Wfdc15a n/a
3 TRCN0000441599 CACAACAACCATCCTCCTTTG pLKO_005 108 CDS 100% 6.000 4.200 N Wfdc15a n/a
4 TRCN0000114722 CTGCTTCTACTACTGTCAGAT pLKO.1 270 CDS 100% 4.950 3.465 N Wfdc15a n/a
5 TRCN0000114721 GAGCAACTAGGAAAGGAGTTA pLKO.1 149 CDS 100% 4.950 3.465 N Wfdc15a n/a
6 TRCN0000114724 AGGAAAGGAGTTACGCCGAAA pLKO.1 157 CDS 100% 4.050 2.835 N Wfdc15a n/a
7 TRCN0000114723 CCGTTTGTCCTGTTACCCGTA pLKO.1 211 CDS 100% 2.160 1.512 N Wfdc15a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183271.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.