Transcript: Mouse NM_183281.2

Mus musculus transmembrane protein 45A2 (Tmem45a2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Tmem45a2 (69457)
Length:
3067
CDS:
168..1037

Additional Resources:

NCBI RefSeq record:
NM_183281.2
NBCI Gene record:
Tmem45a2 (69457)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217452 GATGAGATCGGGTATGGTAAA pLKO.1 1887 3UTR 100% 10.800 15.120 N Tmem45a2 n/a
2 TRCN0000190806 GCAACACATCATCATGTACGT pLKO.1 485 CDS 100% 2.640 2.112 N Tmem45a2 n/a
3 TRCN0000191035 CAAGATCTTATGTTTCACCAT pLKO.1 530 CDS 100% 2.640 1.848 N Tmem45a2 n/a
4 TRCN0000190904 CACATTCTTCCTGGAGTCTTT pLKO.1 231 CDS 100% 4.950 2.970 N Tmem45a2 n/a
5 TRCN0000201350 GCAAGCTTTATCCATCAGAAA pLKO.1 964 CDS 100% 4.950 2.970 N Tmem45a2 n/a
6 TRCN0000190753 GCCAGTCTCTTTGATCACATA pLKO.1 560 CDS 100% 4.950 3.465 N Tmem45a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.