Transcript: Mouse NM_183288.3

Mus musculus Rho GTPase activating protein 27 (Arhgap27), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Arhgap27 (544817)
Length:
2099
CDS:
571..1302

Additional Resources:

NCBI RefSeq record:
NM_183288.3
NBCI Gene record:
Arhgap27 (544817)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281643 ACGGATGCATGCGCCGAATAA pLKO_005 1431 3UTR 100% 13.200 18.480 N Arhgap27 n/a
2 TRCN0000183766 CCACCTCACTTATTAAGTATT pLKO.1 1320 3UTR 100% 13.200 18.480 N Arhgap27 n/a
3 TRCN0000264779 CTTCGAGTACACCGGCAAAGA pLKO_005 618 CDS 100% 4.950 6.930 N Arhgap27 n/a
4 TRCN0000264776 TAGCGACTCGGAGAATGTCTA pLKO_005 1152 CDS 100% 4.950 6.930 N Arhgap27 n/a
5 TRCN0000264777 TTAACTGAGGCCACTGGATGT pLKO_005 1295 CDS 100% 4.050 5.670 N Arhgap27 n/a
6 TRCN0000180459 GACTCTCTTCTTCCCTAGAAA pLKO.1 1499 3UTR 100% 5.625 3.938 N Arhgap27 n/a
7 TRCN0000195828 CTGCTCGGTAAGGAACAGTTT pLKO.1 1469 3UTR 100% 4.950 3.465 N Arhgap27 n/a
8 TRCN0000264778 AGTCCAGCAGAGTCTAGATGC pLKO_005 1263 CDS 100% 4.050 2.835 N Arhgap27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.