Transcript: Mouse NM_183293.1

Mus musculus coiled-coil domain containing 83 (Ccdc83), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ccdc83 (75338)
Length:
1399
CDS:
132..1358

Additional Resources:

NCBI RefSeq record:
NM_183293.1
NBCI Gene record:
Ccdc83 (75338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438151 GCACGCTCAACTCATTGTTTC pLKO_005 572 CDS 100% 10.800 15.120 N Ccdc83 n/a
2 TRCN0000176602 CAAGAACAACTATCGAGAGAT pLKO.1 755 CDS 100% 4.950 6.930 N Ccdc83 n/a
3 TRCN0000413584 GAGCGATTCATGTTCCATATC pLKO_005 252 CDS 100% 10.800 8.640 N Ccdc83 n/a
4 TRCN0000431925 ATGACATCGACACAGTTAAAG pLKO_005 601 CDS 100% 13.200 9.240 N Ccdc83 n/a
5 TRCN0000414090 ATGAGGCTGAGAAGCTATTTC pLKO_005 493 CDS 100% 13.200 9.240 N Ccdc83 n/a
6 TRCN0000176784 CTGGACTATCATCGTGAAATA pLKO.1 216 CDS 100% 13.200 9.240 N Ccdc83 n/a
7 TRCN0000176843 GAAACAATGATCCAACTGAAA pLKO.1 690 CDS 100% 4.950 3.465 N Ccdc83 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183293.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.