Transcript: Mouse NM_183311.2

Mus musculus transmembrane protein 145 (Tmem145), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Tmem145 (330485)
Length:
2298
CDS:
57..1748

Additional Resources:

NCBI RefSeq record:
NM_183311.2
NBCI Gene record:
Tmem145 (330485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249276 CACTGTTTAGAGACGGATATT pLKO_005 2119 3UTR 100% 13.200 18.480 N Tmem145 n/a
2 TRCN0000217107 CGTGAAAGATGGTGGTATATC pLKO.1 480 CDS 100% 13.200 18.480 N Tmem145 n/a
3 TRCN0000249275 CGTGAAAGATGGTGGTATATC pLKO_005 480 CDS 100% 13.200 18.480 N Tmem145 n/a
4 TRCN0000201667 GCCACTGTTTAGAGACGGATA pLKO.1 2117 3UTR 100% 4.050 5.670 N Tmem145 n/a
5 TRCN0000249274 TGACCCAGGCCAGGTACTATA pLKO_005 1004 CDS 100% 13.200 10.560 N Tmem145 n/a
6 TRCN0000191665 GAAGTTGGTCTCTACTTTGAA pLKO.1 2142 3UTR 100% 5.625 4.500 N Tmem145 n/a
7 TRCN0000164448 CCATGGCGTGTTTCTGATCAT pLKO.1 1277 CDS 100% 4.950 3.960 N TMEM145 n/a
8 TRCN0000215940 CTCTTGTTACTTTGGATATTT pLKO.1 659 CDS 100% 15.000 10.500 N Tmem145 n/a
9 TRCN0000249273 TCTATGCCCATGGCGTGTTTC pLKO_005 1270 CDS 100% 10.800 7.560 N Tmem145 n/a
10 TRCN0000192605 GAGAGAAGATAGTCAACGGTA pLKO.1 1231 CDS 100% 2.640 1.848 N Tmem145 n/a
11 TRCN0000161899 GTCAGAACATCCTCCTCTATT pLKO.1 262 CDS 100% 13.200 10.560 N TMEM145 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183311.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.