Transcript: Human NM_183395.2

Homo sapiens NLR family pyrin domain containing 3 (NLRP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NLRP3 (114548)
Length:
4128
CDS:
747..3515

Additional Resources:

NCBI RefSeq record:
NM_183395.2
NBCI Gene record:
NLRP3 (114548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432208 GTGGATCTAGCCACGCTAATG pLKO_005 900 CDS 100% 10.800 15.120 N NLRP3 n/a
2 TRCN0000420883 TCATCATTCCCGCTATCTTTC pLKO_005 3896 3UTR 100% 10.800 8.640 N NLRP3 n/a
3 TRCN0000062723 CCGTAAGAAGTACAGAAAGTA pLKO.1 1154 CDS 100% 5.625 4.500 N NLRP3 n/a
4 TRCN0000427726 CCTCATGTAATTAGCTCATTC pLKO_005 3786 3UTR 100% 10.800 7.560 N NLRP3 n/a
5 TRCN0000062726 GCGTTAGAAACACTTCAAGAA pLKO.1 3453 CDS 100% 4.950 3.465 N NLRP3 n/a
6 TRCN0000062727 GCTGGAATTGTTCTACTGTTT pLKO.1 2627 CDS 100% 4.950 3.465 N NLRP3 n/a
7 TRCN0000101069 CCACATGACTTTCCAGGAGTT pLKO.1 2309 CDS 100% 4.050 2.430 N Nlrp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.