Transcript: Human NM_194248.3

Homo sapiens otoferlin (OTOF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
OTOF (9381)
Length:
7214
CDS:
186..6179

Additional Resources:

NCBI RefSeq record:
NM_194248.3
NBCI Gene record:
OTOF (9381)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006983 CGCAATGAGAACGATGAGTTT pLKO.1 5868 CDS 100% 4.950 6.930 N OTOF n/a
2 TRCN0000006985 CGTCCCTGATCCACAATTATA pLKO.1 3691 CDS 100% 15.000 10.500 N OTOF n/a
3 TRCN0000414532 GTCAGTGCCCAGGGCTTTAAA pLKO_005 6759 3UTR 100% 15.000 10.500 N OTOF n/a
4 TRCN0000431412 TGCAGATAGCACCGGTCTTTG pLKO_005 6818 3UTR 100% 10.800 7.560 N OTOF n/a
5 TRCN0000006982 CCGCCCATCATTGTCATTGAA pLKO.1 3270 CDS 100% 5.625 3.938 N OTOF n/a
6 TRCN0000006984 CCTGTCTTTGGGAAGTCCTTT pLKO.1 4800 CDS 100% 4.950 2.970 N OTOF n/a
7 TRCN0000006981 CCCTGCAGATAGCACCGGTAT pLKO.1 6815 3UTR 100% 1.350 1.890 N OTOF n/a
8 TRCN0000086689 CCGCGTCTTCTTCATCAATGA pLKO.1 3140 CDS 100% 4.950 2.475 Y LOC434230 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194248.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.