Transcript: Human NM_194250.2

Homo sapiens zinc finger protein 804A (ZNF804A), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ZNF804A (91752)
Length:
4527
CDS:
432..4061

Additional Resources:

NCBI RefSeq record:
NM_194250.2
NBCI Gene record:
ZNF804A (91752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422899 AGTCCCATTAGCAGATCAAAT pLKO_005 1415 CDS 100% 13.200 18.480 N ZNF804A n/a
2 TRCN0000129949 GCGTCATTGGTTTGAAATCAT pLKO.1 4178 3UTR 100% 5.625 7.875 N ZNF804A n/a
3 TRCN0000129899 GCTGGTTTATACAACTACGAA pLKO.1 1760 CDS 100% 3.000 4.200 N ZNF804A n/a
4 TRCN0000433328 TTAGCTGCAGAGCAATTATTA pLKO_005 2361 CDS 100% 15.000 12.000 N ZNF804A n/a
5 TRCN0000127826 GCATGGGACCACTTTCAGATT pLKO.1 1909 CDS 100% 4.950 3.960 N ZNF804A n/a
6 TRCN0000128318 GCTGCGTTATAATTCAGGAAT pLKO.1 3404 CDS 100% 4.950 3.465 N ZNF804A n/a
7 TRCN0000128532 CACAGCCTAAATCCTATCTTT pLKO.1 3322 CDS 100% 5.625 3.375 N ZNF804A n/a
8 TRCN0000128661 CAAGCATTATTGATCCCACTA pLKO.1 3525 CDS 100% 4.050 2.430 N ZNF804A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.