Transcript: Human NM_194286.4

Homo sapiens serine/arginine repetitive matrix 4 (SRRM4), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SRRM4 (84530)
Length:
8431
CDS:
343..2178

Additional Resources:

NCBI RefSeq record:
NM_194286.4
NBCI Gene record:
SRRM4 (84530)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172648 GCATCATTGTCGCCAGTATCA pLKO.1 431 CDS 100% 4.950 6.930 N SRRM4 n/a
2 TRCN0000168697 GAGAAGAGGCACAAGAAACAA pLKO.1 838 CDS 100% 5.625 3.938 N SRRM4 n/a
3 TRCN0000168199 CCTCTCATGACAAAGACTTGA pLKO.1 623 CDS 100% 4.950 3.465 N SRRM4 n/a
4 TRCN0000168787 GAAGAAATCCACTCGGAAGAA pLKO.1 678 CDS 100% 4.950 3.465 N SRRM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194286.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.