Transcript: Mouse NM_194341.2

Mus musculus synergin, gamma (Synrg), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Synrg (217030)
Length:
7112
CDS:
46..3462

Additional Resources:

NCBI RefSeq record:
NM_194341.2
NBCI Gene record:
Synrg (217030)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_194341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093326 CGAGCAAACGACAGACAGTAA pLKO.1 1431 CDS 100% 4.950 3.960 N Synrg n/a
2 TRCN0000093325 GCAGACGACTTTGGAGAATTT pLKO.1 2614 CDS 100% 13.200 9.240 N Synrg n/a
3 TRCN0000369685 TGCTGAAGGACATCGATAAAG pLKO_005 3155 CDS 100% 13.200 9.240 N SYNRG n/a
4 TRCN0000364818 TTGGTTCCAGATGCCTATAAG pLKO_005 694 CDS 100% 13.200 9.240 N SYNRG n/a
5 TRCN0000093324 GCTGCTGAAGTGTATGTGAAA pLKO.1 3921 3UTR 100% 4.950 3.465 N Synrg n/a
6 TRCN0000093328 CTCCATTTCATCTGAGCCAAA pLKO.1 1893 CDS 100% 4.050 2.835 N Synrg n/a
7 TRCN0000093327 GCTCCATTTCATCTGAGCCAA pLKO.1 1892 CDS 100% 2.640 1.848 N Synrg n/a
8 TRCN0000182745 CCAGAGTTCAAATCCCAGCAA pLKO.1 4488 3UTR 100% 2.640 1.320 Y P3h3 n/a
9 TRCN0000320070 CCAGAGTTCAAATCCCAGCAA pLKO_005 4488 3UTR 100% 2.640 1.320 Y P3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194341.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.