Transcript: Mouse NM_197945.4

Mus musculus leucine zipper, putative tumor suppressor family member 3 (Lzts3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Lzts3 (241638)
Length:
4319
CDS:
216..2318

Additional Resources:

NCBI RefSeq record:
NM_197945.4
NBCI Gene record:
Lzts3 (241638)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_197945.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255799 ACCAGCCATATCAACCGTATT pLKO_005 1038 CDS 100% 10.800 15.120 N Lzts3 n/a
2 TRCN0000255796 ATCCCTCACAATACGTGATTC pLKO_005 4071 3UTR 100% 10.800 15.120 N Lzts3 n/a
3 TRCN0000193747 CCTGTTGTACCCAAGAACTTT pLKO.1 801 CDS 100% 5.625 7.875 N Lzts3 n/a
4 TRCN0000255800 GCGCATCGAGTCCACTGAAAT pLKO_005 2294 CDS 100% 13.200 9.240 N Lzts3 n/a
5 TRCN0000255798 TGTACCCAAGAACTTTCATTC pLKO_005 806 CDS 100% 10.800 7.560 N Lzts3 n/a
6 TRCN0000174857 GTTGTACCCAAGAACTTTCAT pLKO.1 804 CDS 100% 5.625 3.938 N Lzts3 n/a
7 TRCN0000194218 GCTTCTCTGGTTTCTGTTGAT pLKO.1 1953 CDS 100% 4.950 3.465 N Lzts3 n/a
8 TRCN0000157584 GTCGCAGAAGTTGAGTGAGAT pLKO.1 1685 CDS 100% 4.950 3.465 N LZTS3 n/a
9 TRCN0000156677 GCAGAAGTTGAGTGAGATCGT pLKO.1 1688 CDS 100% 2.640 1.848 N LZTS3 n/a
10 TRCN0000285377 GCAGAAGTTGAGTGAGATCGT pLKO_005 1688 CDS 100% 2.640 1.848 N LZTS3 n/a
11 TRCN0000255797 CACAAGCTTGCCCACCTATAG pLKO_005 977 CDS 100% 10.800 6.480 N Lzts3 n/a
12 TRCN0000157866 CCAGACCAAAGAGGTTCTCTA pLKO.1 2419 3UTR 100% 4.950 3.465 N LZTS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_197945.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.