Transcript: Mouse NM_198007.2

Mus musculus activating signal cointegrator 1 complex subunit 3 (Ascc3), mRNA.

Source:
NCBI, updated 2017-04-17
Taxon:
Mus musculus (mouse)
Gene:
Ascc3 (77987)
Length:
7477
CDS:
272..6868

Additional Resources:

NCBI RefSeq record:
NM_198007.2
NBCI Gene record:
Ascc3 (77987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352501 TTGTGGTGTGACGGGTTAAAT pLKO_005 7228 3UTR 100% 15.000 21.000 N Ascc3 n/a
2 TRCN0000052184 CCAGTGATAAATGTTGGCATA pLKO.1 6374 CDS 100% 4.050 3.240 N ASCC3 n/a
3 TRCN0000341734 TAATGCCACTAATCGAATTAT pLKO_005 664 CDS 100% 15.000 10.500 N Ascc3 n/a
4 TRCN0000341735 AGATTGCTGGAGGTACAATAA pLKO_005 5487 CDS 100% 13.200 9.240 N Ascc3 n/a
5 TRCN0000341736 GAATTGCCTCCTATTACTATT pLKO_005 5724 CDS 100% 13.200 9.240 N Ascc3 n/a
6 TRCN0000341807 TAGAATCCAGTCTATAGTATT pLKO_005 1708 CDS 100% 13.200 9.240 N Ascc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.