Transcript: Mouse NM_198022.2

Mus musculus trinucleotide repeat containing 6C (Tnrc6c), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tnrc6c (217351)
Length:
8740
CDS:
436..6138

Additional Resources:

NCBI RefSeq record:
NM_198022.2
NBCI Gene record:
Tnrc6c (217351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218770 CACTATTAACCTCGCCAATTA pLKO_005 4475 CDS 100% 13.200 18.480 N TNRC6C n/a
2 TRCN0000265247 CACTATTAACCTCGCCAATTA pLKO_005 4475 CDS 100% 13.200 18.480 N Tnrc6c n/a
3 TRCN0000229607 GTTGCGCGCACAATCACTAAT pLKO_005 4627 CDS 100% 13.200 18.480 N TNRC6C n/a
4 TRCN0000251809 GTTGCGCGCACAATCACTAAT pLKO_005 4627 CDS 100% 13.200 18.480 N Tnrc6c n/a
5 TRCN0000004493 CTGCACTATTAACCTCGCCAA pLKO.1 4472 CDS 100% 2.160 3.024 N TNRC6C n/a
6 TRCN0000251810 GTGGGCTGGAAAGGGTTATTT pLKO_005 6442 3UTR 100% 15.000 12.000 N Tnrc6c n/a
7 TRCN0000251807 TACTTCCACCAGCACTATTTC pLKO_005 579 CDS 100% 13.200 10.560 N Tnrc6c n/a
8 TRCN0000251808 CAGTGGATTGGTAGATCATTA pLKO_005 858 CDS 100% 13.200 9.240 N Tnrc6c n/a
9 TRCN0000229608 TGCTATCCCTGGAGGTCTAAG pLKO_005 5037 CDS 100% 10.800 7.560 N TNRC6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198022.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.