Transcript: Mouse NM_198024.2

Mus musculus RAN binding protein 3-like (Ranbp3l), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ranbp3l (223332)
Length:
4298
CDS:
478..1953

Additional Resources:

NCBI RefSeq record:
NM_198024.2
NBCI Gene record:
Ranbp3l (223332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198024.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192088 CGGTGCATTGAAATCCTACAA pLKO.1 990 CDS 100% 4.950 6.930 N Ranbp3l n/a
2 TRCN0000192639 GCGACTGATTTAGAAGACGAT pLKO.1 1675 CDS 100% 2.640 3.696 N Ranbp3l n/a
3 TRCN0000191383 CCTGAGACTTTACAAACTGTT pLKO.1 2947 3UTR 100% 4.950 3.960 N Ranbp3l n/a
4 TRCN0000192647 GCGAATAACTGCGACTGATTT pLKO.1 1665 CDS 100% 13.200 9.240 N Ranbp3l n/a
5 TRCN0000201339 GCCTCCATACAACAGAAGTAT pLKO.1 3037 3UTR 100% 5.625 3.938 N Ranbp3l n/a
6 TRCN0000192111 CTGAAGTTGGAAGTTCCTCTA pLKO.1 1040 CDS 100% 4.050 2.835 N Ranbp3l n/a
7 TRCN0000217573 GTCATTGCTCAGCCAATATTT pLKO.1 577 CDS 100% 15.000 9.000 N Ranbp3l n/a
8 TRCN0000201958 CCACAGAATCCTGGAGTGAAA pLKO.1 1487 CDS 100% 4.950 2.970 N Ranbp3l n/a
9 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 3818 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198024.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.