Transcript: Mouse NM_198028.3

Mus musculus serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 10 (Serpinb10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Serpinb10 (241197)
Length:
3490
CDS:
218..1291

Additional Resources:

NCBI RefSeq record:
NM_198028.3
NBCI Gene record:
Serpinb10 (241197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079939 CCTGGAAATTCTTACGTTCTT pLKO.1 401 CDS 100% 4.950 6.930 N Serpinb10 n/a
2 TRCN0000079942 CAGCCAGAGTAAAGCTGATTT pLKO.1 1042 CDS 100% 13.200 9.240 N Serpinb10 n/a
3 TRCN0000079938 CTGCATCTCTCATTTAATGAA pLKO.1 1295 3UTR 100% 5.625 3.938 N Serpinb10 n/a
4 TRCN0000079941 GAGGGTAGAAACATCTTCTTT pLKO.1 167 5UTR 100% 5.625 3.938 N Serpinb10 n/a
5 TRCN0000079940 GTGCAAATGATGTCAATGAAA pLKO.1 746 CDS 100% 5.625 3.938 N Serpinb10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198028.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.