Transcript: Human NM_198086.3

Homo sapiens ajuba LIM protein (AJUBA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
AJUBA (84962)
Length:
2905
CDS:
274..639

Additional Resources:

NCBI RefSeq record:
NM_198086.3
NBCI Gene record:
AJUBA (84962)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365047 TGGACCGGGATTATCACTTTG pLKO_005 476 CDS 100% 10.800 15.120 N AJUBA n/a
2 TRCN0000370155 GTGTCTGTGGTCACTTGATTT pLKO_005 233 5UTR 100% 13.200 9.240 N AJUBA n/a
3 TRCN0000365048 GACTTCTCCAACCAAGTATAC pLKO_005 352 CDS 100% 10.800 7.560 N AJUBA n/a
4 TRCN0000074210 CTGTGTACTGTGAGGAAGATT pLKO.1 173 5UTR 100% 5.625 3.938 N AJUBA n/a
5 TRCN0000074208 GCTCCTTATCTGTCTGAGAAT pLKO.1 1432 3UTR 100% 4.950 3.465 N AJUBA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198086.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.