Transcript: Mouse NM_198106.4

Mus musculus solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1 (Slc9c1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc9c1 (208169)
Length:
3879
CDS:
212..3739

Additional Resources:

NCBI RefSeq record:
NM_198106.4
NBCI Gene record:
Slc9c1 (208169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198193 CCTCAGTGTTATCCTTAGTTA pLKO.1 810 CDS 100% 5.625 7.875 N Slc9c1 n/a
2 TRCN0000178182 GCAGTTACTAAACTAGGTCTT pLKO.1 1535 CDS 100% 4.050 3.240 N Slc9c1 n/a
3 TRCN0000178516 CCAATGGCAGTTACTAAACTA pLKO.1 1529 CDS 100% 5.625 3.938 N Slc9c1 n/a
4 TRCN0000182432 GCAGTCTGTTATCCAGCCATT pLKO.1 2830 CDS 100% 4.050 2.835 N Slc9c1 n/a
5 TRCN0000198297 GCCATAACCTTTATTCAGGAA pLKO.1 2903 CDS 100% 2.640 1.848 N Slc9c1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.