Transcript: Mouse NM_198109.4

Mus musculus slingshot homolog 1 (Drosophila) (Ssh1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ssh1 (231637)
Length:
3174
CDS:
26..3154

Additional Resources:

NCBI RefSeq record:
NM_198109.4
NBCI Gene record:
Ssh1 (231637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198109.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081243 CCCGTTTAGATCACACCAGTA pLKO.1 2709 CDS 100% 4.050 5.670 N Ssh1 n/a
2 TRCN0000081244 GCAGCGATGAAGAACGGAAAT pLKO.1 105 CDS 100% 10.800 7.560 N Ssh1 n/a
3 TRCN0000081247 GCAAATGAACTGCAACCTGAA pLKO.1 871 CDS 100% 4.050 2.835 N Ssh1 n/a
4 TRCN0000081246 CGCGATGCCATGTTTGGAATT pLKO.1 1928 CDS 100% 0.000 0.000 N Ssh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198109.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.