Transcript: Mouse NM_198112.2

Mus musculus osteocrin (Ostn), mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Mus musculus (mouse)
Gene:
Ostn (239790)
Length:
1268
CDS:
62..454

Additional Resources:

NCBI RefSeq record:
NM_198112.2
NBCI Gene record:
Ostn (239790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201697 GTAGAGCATAGAGGGAAACAA pLKO.1 347 CDS 100% 5.625 4.500 N Ostn n/a
2 TRCN0000217551 CAGAGGCTGATGGATTCTTAT pLKO.1 445 CDS 100% 13.200 9.240 N Ostn n/a
3 TRCN0000247266 CAGAGGCTGATGGATTCTTAT pLKO_005 445 CDS 100% 13.200 9.240 N Ostn n/a
4 TRCN0000191069 CCTGAGCAATTGTGTTCTTTA pLKO.1 973 3UTR 100% 13.200 9.240 N Ostn n/a
5 TRCN0000247265 CCTTAGAGAATGACGTATTTG pLKO_005 261 CDS 100% 13.200 9.240 N Ostn n/a
6 TRCN0000247268 GTTGAGTTGTGCAGATCATTT pLKO_005 617 3UTR 100% 13.200 9.240 N Ostn n/a
7 TRCN0000191536 GAAAGCAGTAGATCATTCAAA pLKO.1 370 CDS 100% 5.625 3.938 N Ostn n/a
8 TRCN0000216934 CTTCATCCTGGCTATGATTGT pLKO.1 91 CDS 100% 4.950 3.465 N Ostn n/a
9 TRCN0000247267 ACTTCATCCTGGCTATGATTG pLKO_005 90 CDS 100% 10.800 6.480 N Ostn n/a
10 TRCN0000257610 ATGGATCGGATTGGTAGAAAC pLKO_005 410 CDS 100% 10.800 6.480 N Ostn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.