Transcript: Human NM_198227.2

Homo sapiens regulator of G protein signaling 12 (RGS12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
RGS12 (6002)
Length:
2699
CDS:
71..2470

Additional Resources:

NCBI RefSeq record:
NM_198227.2
NBCI Gene record:
RGS12 (6002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423534 GAACACTAGGCAAGTCTAATT pLKO_005 1548 CDS 100% 13.200 18.480 N RGS12 n/a
2 TRCN0000014272 GCTGGATCTTGTTCCGATTAA pLKO.1 1234 CDS 100% 13.200 9.240 N RGS12 n/a
3 TRCN0000014269 CGGCTTTCAAAGAGAGAAGAA pLKO.1 1613 CDS 100% 4.950 3.465 N RGS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.