Transcript: Mouse NM_198248.1

Mus musculus zinc finger and BTB domain containing 40 (Zbtb40), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
Zbtb40 (230848)
Length:
7208
CDS:
98..3874

Additional Resources:

NCBI RefSeq record:
NM_198248.1
NBCI Gene record:
Zbtb40 (230848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225638 CAGTCTAACTGGGCCTATAAA pLKO_005 6937 3UTR 100% 15.000 12.000 N LOC638050 n/a
2 TRCN0000124800 CGGTTCTGTGATTGCACCATT pLKO.1 161 CDS 100% 4.950 3.960 N Zbtb40 n/a
3 TRCN0000124799 CCCTTGGAATTTGTGTATTTA pLKO.1 6141 3UTR 100% 15.000 10.500 N Zbtb40 n/a
4 TRCN0000218367 ACCCTTATGACTGCAAGAAAT pLKO_005 2997 CDS 100% 13.200 9.240 N LOC638050 n/a
5 TRCN0000124803 GCCTCAGAAGGAGACCATAAT pLKO.1 916 CDS 100% 13.200 9.240 N Zbtb40 n/a
6 TRCN0000225635 TGGACCTCCTGCTGGACAATT pLKO_005 1374 CDS 100% 13.200 9.240 N LOC638050 n/a
7 TRCN0000225636 TCATGCAGACCCTCGTGAAAC pLKO_005 1647 CDS 100% 10.800 7.560 N LOC638050 n/a
8 TRCN0000124802 CCATTTCTACTGCCGTCTGAA pLKO.1 2386 CDS 100% 4.950 3.465 N Zbtb40 n/a
9 TRCN0000124801 GCTGGATGGTACTGTCACATT pLKO.1 3832 CDS 100% 4.950 3.465 N Zbtb40 n/a
10 TRCN0000455146 GTGGTAAGAGATGTCTCAGTG pLKO_005 470 CDS 100% 4.050 2.835 N Zbtb40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.