Transcript: Mouse NM_198250.1

Mus musculus leucine rich repeat containing 4B (Lrrc4b), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Lrrc4b (272381)
Length:
2753
CDS:
81..2210

Additional Resources:

NCBI RefSeq record:
NM_198250.1
NBCI Gene record:
Lrrc4b (272381)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108541 CGTGCAAGAGACACAAATCTA pLKO.1 2189 CDS 100% 5.625 7.875 N Lrrc4b n/a
2 TRCN0000108543 CGCATTTCAGTGCTGCACGAT pLKO.1 1320 CDS 100% 2.640 2.112 N Lrrc4b n/a
3 TRCN0000438801 TGAAGAGGCTGGAGTACATAT pLKO_005 661 CDS 100% 13.200 9.240 N Lrrc4b n/a
4 TRCN0000108542 CCTGGGCATGTGCAACCTAAA pLKO.1 725 CDS 100% 10.800 7.560 N Lrrc4b n/a
5 TRCN0000447561 GAAGGGAGGTTTGCGTCAATC pLKO_005 2647 3UTR 100% 10.800 7.560 N Lrrc4b n/a
6 TRCN0000454516 TACACGTGCATGGTGACAAAC pLKO_005 1386 CDS 100% 10.800 7.560 N Lrrc4b n/a
7 TRCN0000108544 AGAACGTGCAAGAGACACAAA pLKO.1 2185 CDS 100% 4.950 3.465 N Lrrc4b n/a
8 TRCN0000108540 TCCTACTCCTTCACCCTCAAA pLKO.1 2508 3UTR 100% 4.950 3.465 N Lrrc4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.