Transcript: Human NM_198488.5

Homo sapiens family with sequence similarity 83 member H (FAM83H), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
FAM83H (286077)
Length:
5632
CDS:
105..3644

Additional Resources:

NCBI RefSeq record:
NM_198488.5
NBCI Gene record:
FAM83H (286077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198488.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165433 GAGGAAGTCCAACTACAGGAT pLKO.1 2773 CDS 100% 2.640 2.112 N FAM83H n/a
2 TRCN0000161974 GAAGTCCAACTACAGGATTTA pLKO.1 2776 CDS 100% 13.200 9.240 N FAM83H n/a
3 TRCN0000166686 CAAGGACAAGTGTTCAGCCAT pLKO.1 3362 CDS 100% 2.640 1.848 N FAM83H n/a
4 TRCN0000166756 CCATGATGTTCTTGTGGGCAT pLKO.1 5432 3UTR 100% 2.160 1.512 N FAM83H n/a
5 TRCN0000162437 CCTAAGAGGGAACTGATTTAA pLKO.1 5221 3UTR 100% 15.000 9.000 N FAM83H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198488.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.