Transcript: Human NM_198504.3

Homo sapiens progestin and adipoQ receptor family member 9 (PAQR9), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PAQR9 (344838)
Length:
2437
CDS:
339..1472

Additional Resources:

NCBI RefSeq record:
NM_198504.3
NBCI Gene record:
PAQR9 (344838)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441492 GAGCAAGTTCTGCCGTCTGTT pLKO_005 632 CDS 100% 4.950 6.930 N PAQR9 n/a
2 TRCN0000060485 CCGTACCGACTGGTGTACCTA pLKO.1 1031 CDS 100% 1.000 1.400 N PAQR9 n/a
3 TRCN0000060483 GTTCCTAAACAGCTCCGAATT pLKO.1 1436 CDS 100% 0.000 0.000 N PAQR9 n/a
4 TRCN0000431541 CATCTGTGCCATTGGTAATAA pLKO_005 1805 3UTR 100% 15.000 10.500 N PAQR9 n/a
5 TRCN0000120971 CAACTTCTGGACGCACTTCAT pLKO.1 593 CDS 100% 4.950 3.465 N Paqr9 n/a
6 TRCN0000060486 GACCAGGTGTACTACGTAGAA pLKO.1 1308 CDS 100% 4.950 3.465 N PAQR9 n/a
7 TRCN0000060487 CGCCTTCTTCTACCTGGACTA pLKO.1 791 CDS 100% 4.050 2.835 N PAQR9 n/a
8 TRCN0000060484 GCTCAACTTCTGGACGCACTT pLKO.1 590 CDS 100% 4.050 2.835 N PAQR9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198504.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.