Transcript: Human NM_198572.3

Homo sapiens spermatogenesis and centriole associated 1 (SPATC1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
SPATC1 (375686)
Length:
2170
CDS:
237..2012

Additional Resources:

NCBI RefSeq record:
NM_198572.3
NBCI Gene record:
SPATC1 (375686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180287 CCCTTCCCGAATGCATAATTC pLKO.1 1328 CDS 100% 13.200 18.480 N SPATC1 n/a
2 TRCN0000242489 AGAAGTTGGTGCGGCTCATTC pLKO_005 310 CDS 100% 10.800 7.560 N SPATC1 n/a
3 TRCN0000242491 GAGCAGCTGGTGAACGCTTAT pLKO_005 1812 CDS 100% 10.800 7.560 N SPATC1 n/a
4 TRCN0000242490 TTTCCTCACGCCAGAACAATG pLKO_005 427 CDS 100% 10.800 7.560 N SPATC1 n/a
5 TRCN0000242488 AGCGCTATGTGAGCGTCATGA pLKO_005 1741 CDS 100% 4.950 3.465 N SPATC1 n/a
6 TRCN0000181048 CTCCAACATCCCAGAGAAGAT pLKO.1 1655 CDS 100% 4.950 3.465 N SPATC1 n/a
7 TRCN0000180126 CAGAGAAGATCATCCAGGCTT pLKO.1 1666 CDS 100% 2.640 1.584 N SPATC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.