Transcript: Mouse NM_198599.2

Mus musculus MAP6 domain containing 1 (Map6d1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Map6d1 (208158)
Length:
3290
CDS:
46..621

Additional Resources:

NCBI RefSeq record:
NM_198599.2
NBCI Gene record:
Map6d1 (208158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184466 GTAGTAGCGACCACGTCTTAT pLKO.1 403 CDS 100% 13.200 18.480 N Map6d1 n/a
2 TRCN0000183174 GAGACTTTCTTGTCTTCTAAA pLKO.1 808 3UTR 100% 13.200 9.240 N Map6d1 n/a
3 TRCN0000369738 TGAAGCCCTCAAGATCCACAA pLKO_005 452 CDS 100% 4.050 2.835 N MAP6D1 n/a
4 TRCN0000184172 CCTCAAGATCCACAAAGGCAA pLKO.1 458 CDS 100% 2.640 1.848 N Map6d1 n/a
5 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 1078 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.