Transcript: Mouse NM_198627.2

Mus musculus V-set and transmembrane domain containing 2-like (Vstm2l), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Vstm2l (277432)
Length:
1381
CDS:
159..767

Additional Resources:

NCBI RefSeq record:
NM_198627.2
NBCI Gene record:
Vstm2l (277432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200613 CCCTGGTGGTTTGTAAATATT pLKO.1 1180 3UTR 100% 15.000 10.500 N Vstm2l n/a
2 TRCN0000189465 CCACCCTGGTGGTTTGTAAAT pLKO.1 1177 3UTR 100% 13.200 9.240 N Vstm2l n/a
3 TRCN0000202388 GCGTGTGCTTTGCTTGCTTAT pLKO.1 826 3UTR 100% 10.800 7.560 N Vstm2l n/a
4 TRCN0000242575 CAGCAACATCTCCCACAAGCT pLKO_005 518 CDS 100% 2.640 1.848 N VSTM2L n/a
5 TRCN0000192308 CTGTTCCTCATCATTCTACCT pLKO.1 926 3UTR 100% 2.640 1.848 N Vstm2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198627.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.