Transcript: Mouse NM_198659.2

Mus musculus sperm tail PG rich repeat containing 2 (Stpg2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Stpg2 (381476)
Length:
2818
CDS:
7..1692

Additional Resources:

NCBI RefSeq record:
NM_198659.2
NBCI Gene record:
Stpg2 (381476)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265103 CGGCTATATGAAGCGATAATA pLKO_005 709 CDS 100% 15.000 21.000 N Stpg2 n/a
2 TRCN0000215531 GCCATAATCTCATTCGTTAAA pLKO.1 1462 CDS 100% 13.200 18.480 N Stpg2 n/a
3 TRCN0000265104 GCCATAATCTCATTCGTTAAA pLKO_005 1462 CDS 100% 13.200 18.480 N Stpg2 n/a
4 TRCN0000265107 CAATGACGATGACACTATTAT pLKO_005 441 CDS 100% 15.000 12.000 N Stpg2 n/a
5 TRCN0000217402 GACCTGGAAAGTACAACATTA pLKO.1 758 CDS 100% 13.200 10.560 N Stpg2 n/a
6 TRCN0000265106 GACCTGGAAAGTACAACATTA pLKO_005 758 CDS 100% 13.200 10.560 N Stpg2 n/a
7 TRCN0000265105 TGCTACGCTCCTGGCTAATTT pLKO_005 2048 3UTR 100% 15.000 10.500 N Stpg2 n/a
8 TRCN0000200901 CCAGATGAAATGTGGGCTTAA pLKO.1 1904 3UTR 100% 10.800 7.560 N Stpg2 n/a
9 TRCN0000200551 CCAGAAACATTGATATTCCTT pLKO.1 383 CDS 100% 3.000 2.100 N Stpg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.